- Clone
- S19004C (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Killer Cell Lectin Like Receptor C1, KLRC1, NK Cell Receptor A
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CAACTCCTGGGACTT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
| Cat # | Size | Price | Quantity Check Availability | Save | ||
|---|---|---|---|---|---|---|
| 375133 | 10 µg | 296€ | ||||
CD159a, also known as NKG2A or KLRC1, is a type II transmembrane protein. It belongs to the killer cell lectin-like receptor family also known as the NKG2 family. It is expressed on NK and NKT cells and T cell subsets. NKG2A is an inhibitory NK cell receptor and it is expressed as a heterodimer with CD94. In human, NKG2A/CD94 complex interacts HLA-E on target cells and inhibits T cells and NK cell effector functions. Recent studies showed that NKG2A blockade enhances the anti-tumor effect of NK cell and CD8+ T cells.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human NKG2A/CD94-transfectants
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Clone S19004C does not cross-react with mouse CD159a.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_2936648 (BioLegend Cat. No. 375133)
Antigen Details
- Structure
- Type II transmembrane proteins of the C-type lectin superfamily
- Distribution
-
NK cells, NKT cells, T cell subsets
- Function
- Inhibiting NK cell receptor
- Ligand/Receptor
- HLA-E
- Cell Type
- Lymphocytes, NK cells, NKT cells, T cells
- Biology Area
- Immuno-Oncology, Immunology
- Molecular Family
- Immune Checkpoint Receptors
- Antigen References
-
- Brooks AG, et al. 1999. J Immunol. 162:305-13.
- Kaiser BK, et al. 2008. Proc Natl Acad Sci U S A. 105: 6696-701.
- Braud VM, et al. 2003. Trends Immunol. 24:162-4.
- Kamiya T, et al. 2019. J Clin Invest. 129:2094.
- André P, et al. 2018. Cell. 175:1731.
- Gene ID
- 3821 View all products for this Gene ID
- UniProt
- View information about CD159a on UniProt.org
Related FAQs
Other Formats
View All CD159a Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD159a (NKG2A)
Human peripheral blood lymphocytes were stained with purifie... -
PE anti-human CD159a (NKG2A)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
APC anti-human CD159a (NKG2A) Antibody
Human peripheral blood lymphocytes were stained with CD3 FIT... -
Pacific Blue™ anti-human CD159a (NKG2A) Antibody
Human peripheral blood lymphocytes were stained with CD3 APC... -
PE/Cyanine7 anti-human CD159a (NKG2A) Antibody
Human peripheral blood lymphocytes were stained with CD3 FIT... -
Alexa Fluor® 647 anti-human CD159a (NKG2A) Antibody
Human peripheral blood lymphocytes were stained with CD3 FIT... -
PE/Cyanine5 anti-human CD159a (NKG2A)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
APC/Fire™ 750 anti-human CD159a (NKG2A)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
Alexa Fluor® 700 anti-human CD159a (NKG2A) Antibody
Human peripheral blood lymphocytes were stained with CD3 FIT... -
PE/Dazzle™ 594 anti-human CD159a (NKG2A) Antibody
Human peripheral blood lymphocytes were stained with CD3 APC... -
Biotin anti-human CD159a (NKG2A) Antibody
Human peripheral blood lymphocytes were stained with CD3 APC... -
Alexa Fluor® 488 anti-human CD159a (NKG2A)
Human peripheral blood lymphocytes were stained with anti-hu... -
PerCP/Cyanine5.5 anti-human CD159a (NKG2A)
Human peripheral blood lymphocytes were stained with anti-hu... -
FITC anti-human CD159a (NKG2A)
Human peripheral blood lymphocytes were stained with anti-hu... -
TotalSeq™-C1374 anti-human CD159a (NKG2A)
-
TotalSeq™-D1374 anti-human CD159a (NKG2A)
-
TotalSeq™-A1374 anti-human CD159a (NKG2A)
-
APC/Fire™ 810 anti-human CD159a (NKG2A)
Human peripheral blood lymphocytes were surface stained with... -
Brilliant Violet 421™ anti-human CD159a (NKG2A)
Human peripheral blood lymphocytes were surface stained with... -
Brilliant Violet 605™ anti-human CD159a (NKG2A)
Human peripheral blood lymphocytes were surface stained with... -
TotalSeq™-B1374 anti-human CD159a (NKG2A)
-
PerCP/Fire™ 806 anti-human CD159a (NKG2A)
Human peripheral blood lymphocytes were stained with anti-hu... -
Brilliant Violet 785™ anti-human CD159a (NKG2A)
Human peripheral blood lymphocytes were stained with anti-hu... -
PerCP/Fire™ 780 anti-human CD159a (NKG2A)
Human peripheral blood lymphocytes were stained with anti-hu... -
Brilliant Violet 650™ anti-human CD159a (NKG2A)
Human peripheral blood lymphocytes were stained with anti-hu... -
PE/Fire™ 810 anti-human CD159a (NKG2A)
Human peripheral blood lymphocytes were stained with anti-hu... -
APC/Cyanine7 anti-human CD159a (NKG2A)
Human peripheral blood lymphocytes were stained with anti-hu... -
Spark Red™ 718 anti-human CD159a (NKG2A) (Flexi-Fluor™)
-
Brilliant Violet 711™ anti-human CD159a (NKG2A)
Human peripheral blood lymphocytes were stained with anti-hu... -
PE/Cyanine7 anti-human CD159a
Typical results from human peripheral blood lymphocytes stai... -
PE/Fire™ 744 anti-human CD159a (NKG2A)
Human peripheral blood lymphocytes were stained with anti-hu... -
Brilliant Violet 510™ anti-human CD159a (NKG2A) Antibody
Human peripheral blood lymphocytes were stained with anti-hu...
Login / Register 


Follow Us