TotalSeq™-D1521 anti-human CD27 Antibody, CD27, M-T271

Pricing & Availability

Clone: M-T271 (See other available formats)
Regulatory Status: RUO
Workshop: V 5T CD27.03
Other Names: S152, T14, TNFRSF7
Isotype: Mouse IgG1, κ
Barcode Sequence: CTAGCAATTCAGAGC
Ave. Rating: Submit a Review
Product Citations: publications

Compare all formats

Cat #

Size

Price

Quantity Check Availability

Save

356451

10 µg

296€

Check Availability

Need larger quantities of this item?
Request Bulk Quote

Description

CD27 is a 50-55 kD type I membrane protein also known as S152 and T14. It is a lymphocyte-specific member of the TNF-receptor superfamily. CD27 is expressed on medullary thymocytes, virtually all mature T cells, some B cells, and NK cells. CD27 binds to CD70, and plays a role in costimulation of T cell activation and regulation of B cell differentiation and proliferation. The cytoplasmic domains of CD27 have also been shown to interact with TRAF2 and TRAF5 to elicit NF-κB and SAPK/JNK activation.

Product Details

Technical Data Sheet (pdf)

Product Details

Verified Reactivity: Human
Reported Reactivity: Baboon, Cynomolgus, Rhesus
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Human T cells from a T-ALL patient.
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: immunohistochemical staining of formalin-fixed paraffin-embedded frozen tissue sections¹, immunofluorescent staining², and ELISA³.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.
RRID: AB_3717161 (BioLegend Cat. No. 356451)

Antigen Details

Structure: TNF-R superfamily, type I transmembrane glycoprotein, 50-55 kD
Distribution: Medullary thymocytes, T and B cell subsets, NK cells
Interaction: CD27 binds to CD70
Ligand/Receptor: CD70
Cell Type: B cells, NK cells, T cells, Thymocytes
Biology Area: Costimulatory Molecules, Immunology
Molecular Family: CD Molecules
Antigen References: 1. Knapp W, et al. 1989. Leucocyte Typing IV: White Cell Differentiation Antigens. Oxford University Press.
2. Schlossman S, et al. 1995. Leucocyte Typing V: White Cell Differentiation Antigens. Oxford University Press.
3. Hintzen R, et al. 1994. Immunol. Today 15:307.
4. Agematsu K, et al. 1995. J. Immunol. 154:3627.
Gene ID: 939 View all products for this Gene ID
UniProt: View information about CD27 on UniProt.org

Documentation

Reviews

Review This Product

Related Protocols

TotalSeq™-D with Mission Bio Tapestri® Single-Cell DNA + Protein Protocol

Related Products

Description	Clone	Applications

Related Pages & Pathways

Pathways

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD27 Reagents Request Custom Conjugation

Description	Clone	Applications
PE/Dazzle™ 594 anti-human CD27	M-T271	FC
APC/Cyanine7 anti-human CD27	M-T271	FC
Biotin anti-human CD27	M-T271	FC
APC/Fire™ 750 anti-human CD27	M-T271	FC
Brilliant Violet 711™ anti-human CD27	M-T271	FC
PerCP anti-human CD27	M-T271	FC
Alexa Fluor® 647 anti-human CD27	M-T271	FC
KIRAVIA Blue 520™ anti-human CD27	M-T271	FC
Purified anti-human CD27	M-T271	FC,IHC-P,ICC,ELISA
FITC anti-human CD27	M-T271	FC
PE anti-human CD27	M-T271	FC
PerCP/Cyanine5.5 anti-human CD27	M-T271	FC
APC anti-human CD27	M-T271	FC
PE/Cyanine7 anti-human CD27	M-T271	FC
Pacific Blue™ anti-human CD27	M-T271	FC
Alexa Fluor® 700 anti-human CD27	M-T271	FC
Brilliant Violet 421™ anti-human CD27	M-T271	FC
Brilliant Violet 510™ anti-human CD27	M-T271	FC
PE/Cyanine5 anti-human CD27	M-T271	FC
PE/Cyanine7 anti-human CD27	M-T271	FC
APC anti-human CD27	M-T271	FC
PerCP/Cyanine5.5 anti-human CD27	M-T271	FC
PE anti-human CD27	M-T271	FC
FITC anti-human CD27	M-T271	FC
Brilliant Violet 650™ anti-human CD27	M-T271	FC
Pacific Blue™ anti-human CD27	M-T271	FC
Spark Violet™ 423 anti-human CD27	M-T271	FC
GMP PE/Cyanine7 anti-human CD27	M-T271	FC
Spark Red™ 718 anti-human CD27 (Flexi-Fluor™)	M-T271	FC
GMP PerCP/Cyanine5.5 anti-human CD27	M-T271	FC
APC/Fire™ 750 anti-human CD27	M-T271	FC
GMP APC anti-human CD27	M-T271	FC
GMP FITC anti-human CD27	M-T271	FC
StarBright UltraViolet 575 anti-human CD27	M-T271	FC
TotalSeq™-A1521 anti-human CD27 Antibody	M-T271	PG
TotalSeq™-B1521 anti-human CD27	M-T271	PG
TotalSeq™-C1521 anti-human CD27	M-T271	PG
TotalSeq™-D1521 anti-human CD27	M-T271	PG
Spark YG™ 581 anti-human CD27 (Flexi-Fluor™)	M-T271	FC
Spark YG™ 593 anti-human CD27 (Flexi-Fluor™)	M-T271	FC

Certificate of Analysis

Go To Top Version: 1 Revision Date: 05.22.2025

For Research Use Only. Not for diagnostic or therapeutic use.

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.